Quick Order

Mouse Latexin Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LXNcDNA Clone Product Information
cDNA Size:669
cDNA Description:ORF Clone of Mus musculus latexin DNA.
Gene Synonym:MGC144352, MGC144353, Lxn
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Mouse Latexin Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Related Products
Product nameProduct name

Mouse Latexin, also known as endogenous carboxypeptidase inhibitor, tissue carboxypeptidase inhibitor, TCI, ECI and LXN, is a cytoplasm protein which belongs to the protease inhibitor I47 (latexin) family. It is highly expressed in heart, prostate, ovary, kidney, pancreas, and colon. Latexin / LXN is the only known endogenous specific inhibitor of zinc-dependent metallocarboxypeptidases (MCPs) present in mammalians so far. Latexin is originally identified as a molecular marker for the regional specification of the neocortex in development in rats. The 222 amino acid latexin in human shows different expression distribution with high levels in heart, prostate, ovary, kidney, pancreas, and colon, but only moderate or low levels in other tissues including brain. Latexin is also expressed at high levels and is inducible in macrophages in concert with other protease inhibitors and potential protease targets, and thus is suggested to play a role in inflammation and innate immunity pathways. Despite of the non-detectable sequence similarity with plant and parasite inhibitors, Latexin is related to a human putative tumor suppressor protein, TIG1. In addition, Latexin is also implicated in Alzheimer's disease.

Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items