Quick Order

Text Size:AAA

Human CA IX Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CA9cDNA Clone Product Information
Gene_bank_ref_id:NM_001216.2
cDNA Size:1380
cDNA Description:ORF Clone of Homo sapiens carbonic anhydrase IX DNA.
Gene Synonym:CA9, MN, CAIX
Species:Human
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human CA IX Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Human CA IX Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10107-ACG$325
Human CA IX Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10107-ACR$325
Human CA IX Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10107-ANG$325
Human CA IX Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10107-ANR$325
Human CA IX Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10107-CF$295
Human CA IX Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10107-CH$295
Human CA IX Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10107-CM$295
Human CA IX Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10107-CY$295
Human CA IX Gene cDNA Clone (full-length ORF Clone)HG10107-M$95
Human CA IX Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10107-M-F$295
Human CA IX Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10107-M-N$295
Human CA IX Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10107-NF$295
Human CA IX Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10107-NH$295
Human CA IX Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10107-NM$295
Human CA IX Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10107-NY$295
Human CA IX Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10107-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Carbonic anhydrases IX (CA IX), also known as membrane antigen MN or CA9, is a member of the carbonic anhydrase (CA) family and may be involved in cell proliferation and cellular transformation. CAs are zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide (H2O + CO2 = H+ + HCO3–) and thus participate in a variety of biological and physical processes. CA IX protein is expressed primarily in carcinoma cells lines, and the expression is cell density dependent and has been shown to be strongly induced by hypoxia, accordingly facilitates adaptation of tumor cells to hypoxic conditions. It is involved in tumorigenesis through many pathways, such as pH regulation and cell adhesion control. CA IX is used as a marker of tumor hypoxia and as a new therapeutic target for many human carcinomas and cancers.

References
  • Loncaster JA, et al. (2001) Carbonic anhydrase (CA IX) expression, a potential new intrinsic marker of hypoxia: correlations with tumor oxygen measurements and prognosis in locally advanced carcinoma of the cervix. Cancer Res. 61(17): 6394-9.
  • Zvada J, et al. (2003) Soluble form of carbonic anhydrase IX (CA IX) in the serum and urine of renal carcinoma patients. Br J Cancer. 89(6): 1067-71.
  • Pan P, et al. (2006) Carbonic anhydrase gene expression in CA II-deficient (Car2-/-) and CA IX-deficient (Car9-/-) mice. J Physiol. 571(Pt 2): 319-27.
  • Zhou GX, et al. (2010) Quantification of carbonic anhydrase IX expression in serum and tissue of renal cell carcinoma patients using enzyme-linked immunosorbent assay: prognostic and diagnostic potentials. Urology. 75(2): 257-61.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"