Quick Order

Text Size:AAA

Mouse CD62L / SELL Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SELLcDNA Clone Product Information
cDNA Size:1119
cDNA Description:ORF Clone of Mus musculus selectin, lymphocyte DNA.
Gene Synonym:Lnhr, CD62L, Ly-22, Lyam1, Ly-m22, Lyam-1, LECAM-1, AI528707, L-selectin, Sell
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

L-selectin (SELL), also known as CD62L, is a key adhesion molecule that regulates both the migration of leukocytes at sites of inflammation and the recirculation of lymphocytes between blood and lymphoid tissues. It belongs to the selectin family of proteins, and consisting of a large, highly glycosylated, extracellular domain, a single spanning transmembrane domain and a small cytoplasmic tail. L-selectin is the only selectin expressed on leukocytes and mediates a number of leukocyte-endothelial interactions. L-selectin acts as a "homing receptor" for leukocytes to enter secondary lymphoid tissues via high endothelial venules. Ligands present on endothelial cells will bind to leukocyte expressing L-selectin, slowing leukocyte trafficking through the blood, and facilitating entry into a secondary lymphoid organ at that point. L-selectin-mediated lymphocyte recirculation is required for maintaining the appropriate tissue distribution of lymphocyte subpopulations including naïve and effector subsets such as regulatory T cells. In addition, L-selectin-mediated entry into peripheral lymph nodes is required for optimal induction of lymphocyte homeostatic proliferation during lymphopenia. Importantly, L-selectin has been shown to have both adhesive and signaling functions during leukocyte migration. L-selectin has also been shown to mediate leukocyte recruitment during chronic inflammatory and autoimmune diseases and thus is a potential therapeutic target for drug development.

  • Smalley DM, et al. (2005) L-selectin: mechanisms and physiological significance of ectodomain cleavage. J Cell Mol Med. 9(2): 255-66.
  • Grailer JJ, et al. (2009) L-selectin: role in regulating homeostasis and cutaneous inflammation. J Dermatol Sci. 56(3): 141-7.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Mouse CD62L / SELL Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items