After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse ADAM9 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse ADAM9 cDNA Clone Product Information
Gene_bank_ref_id:NM_007404.2
RefSeq ORF Size:2538bp
cDNA Description:Full length Clone DNA of Mus musculus a disintegrin and metallopeptidase domain 9 (meltrin gamma).
Gene Synonym:MDC9, Mltng, AU020942, mKIAA0021, Adam9
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

ADAM9 (A disintegrin and metallopeptidase domain 9, MDC9, meltrin gamma), is a type 1 transmembrane protein that has been associated with cancer development and metastases. ADAM9 is consistently overexpressed in various human cancers, and plays a role in tumorigenesis in mouse models. ADAM9 cleaves and releases a number of molecules with important roles in tumorigenesis and angiogenesis, such as EGF, FGFR2iiib, Tie-2, Flk-1, EphB4, CD40, VCAM-1, and VE-cadherin, and could represent a potential therapeutic target in tumors where it is highly expressed. ADAM9 belongs to a family of transmembrane, disintegrin-containing metalloproteinases involved in protein ectodomain shedding and cell-cell and cell-matrix interactions. ADAM-9 adhesive domain plays a role in regulating the motility of cells by interaction with beta1 integrins and modulates MMP synthesis.

References
  • Caltabiano R, et al. (2011) ADAM-9 expression in intestinal-type adenocarcinoma of the sinonasal tract. Appl Immunohistochem Mol Morphol. 19(3): 283-7.
  • Peduto L. (2009) ADAM9 as a potential target molecule in cancer. Curr Pharm Des. 15(20): 2282-7.
  • Zigrino P, et al. (2007) Role of ADAM-9 disintegrin-cysteine-rich domains in human keratinocyte migration. J Biol Chem. 282(42): 30785-93.
  • Size / Price
    Catalog: MG50044-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"