Quick Order

Human CD84 / SLAMF5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD84cDNA Clone Product Information
cDNA Size:987
cDNA Description:ORF Clone of Homo sapiens CD84 molecule DNA.
Gene Synonym:LY9B, hCD84, mCD84, SLAMF5, DKFZp781E2378
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human CD84 / SLAMF5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Related Products
Product nameProduct name

The CD2 family receptors are type I transmembrane glycoproteins belonging to immunoglobulin (Ig) superfamily characterized by a membrane-proximal Ig constant 2 (C2) domain and a membrane-distal variable (V) domain that is responsible for ligand recognition. CD84, also known as LY9B and SLAMF5, is a homophilic member of the SLAM (signaling lymphocyte activation molecule) subfamily of the CD2 family. The SLAM family receptorsmediate signal transduction through the interaction of its ITSM (immunoreceptor tyrosine-based switch motifs) in the intracellular region and the SH2 domain of adaptor molecules SAP (SLAM-associated protein) and EAT-2 (EWS-activated transcript 2), and accordingly modulate both adaptive and innate immune responses. The CD84-CD84 interaction was independent of its cytoplasmic tail. Thus, CD84 is its own ligand and acts as a costimulatory molecule. CD84 is expressed on cells from almost all hematopoietic lineages and on CD34+ hematopoietic progenitor cells, suggesting that CD84 serves as a marker for committed hematopoietic progenitor cells.

  • Martin M, et al. (2001) CD84 functions as a homophilic adhesion molecule and enhances IFN-gamma secretion: adhesion is mediated by Ig-like domain 1. J Immunol. 167(7): 3668-76.
  • Tangye SG, et al. (2002) CD84 is up-regulated on a major population of human memory B cells and recruits the SH2 domain containing proteins SAP and EAT-2. Eur J Immunol. 32(6): 1640-9.
  • Zaiss M, et al. (2003) CD84 expression on human hematopoietic progenitor cells. Exp Hematol. 31(9): 798-805.
  • Tangye SG, et al. (2003) Functional requirements for interactions between CD84 and Src homology 2 domain-containing proteins and their contribution to human T cell activation. J Immunol. 171(5): 2485-95.
  • Yan Q, et al. (2007) Structure of CD84 provides insight into SLAM family function. Proc Natl Acad Sci U S A. 104(25): 10583-8.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks