After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse Hgfac Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HGFAcDNA Clone Product Information
cDNA Size:1962
cDNA Description:ORF Clone of Mus musculus hepatocyte growth factor activator DNA.
Gene Synonym:HGFA, Hgfac
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

HGF activator (HGFA) is a serum-derived serine protease and belongs to the peptidase family S1.HGFA is responsible for the conversion of hepatocyte growth factor (HGF), from the inactive single-chain precursor to the active heterodimeric form, which is a potent mitogen, motogen, and morphogen for liver cells, epithelial cells, and endothelial cells. HGFA is synthesized and secreted by the liver and circulates in the plasma as an inactive single-chain zymogen in normal states. The zymogen is cleaved by thrombin or thermolysin through the endoproteolytic process and forms an active heterodimer linked by a disulfide bond. In turn, the active protease can be inhibited by HGFA inhibitors (HAIs) including HAI-1 and HAI-2. In addition, the HGFA zymogen acquires a strong affinity upon activation and thus may ensure the local action in tissue regeneration in liver, kidney and skin. It has been reported that activation of HGF is a critical limiting step in the HGF/SF-induced signaling pathway mediated by Met, and accordingly, aberrant expression of HGFA is implicated in tumorigenesis and progression.


1.  Shimomura, T. et al., 1993, J. Biol. Chem. 268: 22927-22932.

2.  Miyazawa, K. et al., 1996, J. Biol. Chem. 271 : 3615-3618.

3.  Shia, S. et al., 2005, J. Mol. Biol. 346: 1335-1349.

4.  Kataoka, H. et al., 2000, J. Biol. Chem. 275: 40453-40462.

5.  Tjin, E.P. et al., 2006, Blood. 107: 760-768.

6.  Kitajima, Y. et al., 2000, Cancer. Res. 60: 6148-6159.

Size / Price
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks