Quick Order

Mouse sFRP-2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse SFRP2 cDNA Clone Product Information
Gene_bank_ref_id:NM_009144.1
RefSeq ORF Size:888bp
cDNA Description:Full length Clone DNA of Mus musculus secreted frizzled-related protein 2.
Gene Synonym:Sdf5, AI851596
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

The Secreted frizzled-related protein (SFRP) family consists of five secreted glycoproteins in humans (SFRP1~5) that act as extracellular signaling ligands. Each SFRP is approximately 300 amino acids in length and contains a cysteine-rich domain (CRD) that shares 30-50% sequence homology with the CRD of Frizzled (Fz) receptors, a putative signal sequence, and a conserved hydrophilic carboxy-terminal domain. SFRPs are able to bind Wnt proteins and Fz receptors in the extracellular compartment. The interaction between SFRPs and Wnt proteins prevents the latter from binding the Fz receptors. The Wnt pathway plays a key role in embryonic development, cell differentiation and cell proliferation. sFRP2 is a member of the SFRP family acting as soluble modulators of Wnt signaling and contains a cysteine-rich domain homologous to the putative Wnt-binding site of Frizzled proteins called FZ domain and a NTR domain.sFRP2 inhibites hypoxia induced endothelial cell apoptosis and increases endothelial cell migration. It prevents mesoderm specification and maintains the cells in the undifferentiated state. SFRP2 is also a novel stimulator of angiogenesis that stimulates angiogenesis via a calcineurin/NFAT pathway, thus is regarded as a favorable target for the inhibition of angiogenesis in solid tumors. Mouse sFRP2 is highly expressed in the eye and is also detected in heart and lung at low level.

Size / Price
Catalog: MG50028-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"