Quick Order

Text Size:AAA

Human CD274 / B7-H1 / PD-L1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD274cDNA Clone Product Information
cDNA Size:912
cDNA Description:ORF Clone of Homo sapiens CD274 molecule DNA.
Gene Synonym:CD274, B7-H, B7H1, PDL1, PD-L1, PDCD1L1, PDCD1LG1
Restriction Site:KpnI + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Programmed death-1 ligand-1 (PD-L1, CD274, B7-H1) has been identified as the ligand for the immunoinhibitory receptor programmed death-1(PD1/PDCD1) and has been demonstrated to play a role in the regulation of immune responses and peripheral tolerance. PD-L1/B7-H1 is a member of the growing B7 family of immune molecules and this protein contains one V-like and one C-like Ig domain within the extracellular domain, and together with PD-L2, are two ligands for PD1 which belongs to the CD28/CTLA4 family expressed on activated lymphoid cells. By binding to PD1 on activated T-cells and B-cells, PD-L1 may inhibit ongoing T-cell responses by inducing apoptosis and arresting cell-cycle progression. Accordingly, it leads to growth of immunogenic tumor growth by increasing apoptosis of antigen specific T cells and may contribute to immune evasion by cancers. PD-L1 thus is regarded as promising therapeutic target for human autoimmune disease and malignant cancers.

  • Iwai Y, et al. (2002) Involvement of PD-L1 on tumor cells in the escape from host immune system and tumor immunotherapy by PD-L1 blockade. Proc Natl Acad Sci U S A. 99(19): 12293-7.
  • Ghebeh H, et al. (2006) The B7-H1 (PD-L1) T lymphocyte-inhibitory molecule is expressed in breast cancer patients with infiltrating ductal carcinoma: correlation with important high-risk prognostic factors. Neoplasia. 8(3): 190-8.
  • Salih HR, et al. (2006) The role of leukemia-derived B7-H1 (PD-L1) in tumor-T-cell interactions in humans. Exp Hematol. 34(7): 888-94.
  • Wilcox RA, et al. (2009) B7-H1 (PD-L1, CD274) suppresses host immunity in T-cell lymphoproliferative disorders. Blood. 114(10): 2149-58.
  • Ruggiero A, et al. (2009) Crystal structure of PD-L1, a ribosome inactivating protein from Phytolacca dioica L. leaves with the property to induce DNA cleavage. Biopolymers. 91(12): 1135-42.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 Business days
    • Human CD274 / B7-H1 / PD-L1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
    Recently Viewed Items