Quick Order

Mouse CCL5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CCL5cDNA Clone Product Information
cDNA Size:276
cDNA Description:ORF Clone of Mus musculus chemokine (C-C motif) ligand 5 DNA.
Gene Synonym:SISd, Scya5, RANTES, TCP228, MuRantes
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Chemokine & Receptor Related Products
Product nameProduct name

Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. Chemokines share the same structure similarities such as small size, and the presence of four cysteine residues in conserved locations in order to form their 3-dimensional shape. Some of the chemokines are considered pro-inflammatory which can be induced to recruit cells of the immune system to a site of infection during an immune response, while others are considered homeostatic and are implied in controlling the migration of cells during normal processes of tissue maintenance and development. There are four members of the chemokine family: C-C kemokines, C kemokines, CXC kemokines and CX3C kemokines. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands-1 to 28. Chemokin ligand 5(CCL5) is chemotactic for T cells, basophils and eosinophils. Chemokin ligand 5(CCL5) has been considered a HIV-supressor secreted by CD8+ T cells and other immune cells. Chemokin ligand 5(CCL5) is a key to activating recruit leukocytes into inflammatory sites and in the presence of particular cytokines released by T cells, it can change the NK cells into CHAK cells.

  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28(5): 443-60.
  • Cocchi F, et al. (1995) Identification of RANTES, MIP-1a, and MIP-1b as the major HIV-suppressive factor produced by CD8+ T cells. Science. 270 (5243): 1811-5.
  • Vangelista L, et al. (2010) Engineering of Lactobacillus jensenii to secrete RANTES and a CCR5 antagonist analogue as live HIV-1 blockers. Antimicrob. Agents Chemother. 54 (7): 2994-3001.
  • Maghazachi AA, et al. (1996) CC chemokines induce the generation of killer cells from CD56+ cells. Eur. J. Immunol. 26 (2): 315-9.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items