Quick Order

Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CASP7 cDNA Clone Product Information
Gene_bank_ref_id:NM_001227.3
RefSeq ORF Size:912bp
cDNA Description:Full length Clone DNA of Homo sapiens caspase 7, apoptosis-related cysteine peptidase (CASP7), transcript variant alpha with C terminal Flag tag.
Gene Synonym:CASP7, MCH3, CMH-1, ICE-LAP3
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-Flag tag on other vectors
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-GFPSpark tagHG10049-ACG$325
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-OFPSpark / RFP tagHG10049-ACR$325
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-GFPSpark tagHG10049-ANG$325
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-OFPSpark / RFP tagHG10049-ANR$325
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-Flag tagHG10049-CF$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-His tagHG10049-CH$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-Myc tagHG10049-CM$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-HA tagHG10049-CY$295
Human Caspase-7 transcript variant alpha Gene cDNA clone plasmidHG10049-M$95
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, Flag tagHG10049-M-F$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-Flag tagHG10049-NF$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-His tagHG10049-NH$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-Myc tagHG10049-NM$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-HA tagHG10049-NY$295
Human Caspase-7 transcript variant alpha natural ORF mammalian expression plasmidHG10049-UT$295
 Learn more about expression Vectors
Product nameProduct name
Background

Caspase 7, also known as caspase-7 and MCH3, belongs to the cysteine-aspartic acid protease (caspase) family. Caspases play a role in the signal transduction pathways of apoptosis, necrosis and inflammation. There are two major classes of caspases: initiators and effectors. The initiator isoforms (caspases-1,-4,-5,-8,-9,-10,-11,-12) are activated by, and interact with, upstream adaptor molecules through protein-protein interaction domains known as CARD and DED. Effector caspases (-3,-6,-7) are responsible for cleaving downstream substrates and are sometimes referred to as the executioner caspases. Caspase 7 exists in lung, skeletal muscle, liver, kidney, spleen and heart, and moderately in testis. Caspase 7 cannot be detected in the brain. Caspase 7 functions in the activation cascade of caspases responsible for apoptosis execution. It cleaves and activates sterol regulatory element binding proteins (SREBPs). It proteolytically cleaves poly(ADP-ribose) polymerase (PARP) at a '216-Asp- -Gly-217' bond. Overexpression promotes programmed cell death.

References
  • Riedl S J, et al. (2001) Structural basis for the inhibition of caspase-3 by XIAP. Cell. 104(5):791-800.
  • Roy N, et al. (1997) The c-IAP-1 and c-IAP-2 proteins are direct inhibitors of specific caspases. EMBO J. 16(23):6914-25.
  • Deveraux Q L, et al. (1997) X-linked IAP is a direct inhibitor of cell-death proteases. Nature. 388(6639): 300-4.
  • Size / Price
    Catalog: HG10049-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"