Quick Order

Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SPARCL1cDNA Clone Product Information
cDNA Size:1995
cDNA Description:ORF Clone of Homo sapiens SPARC-like 1 (hevin), transcript variant 2 DNA.
Gene Synonym:SC1, PIG33, SPARCL1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10046-ACG$345
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10046-ACR$345
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10046-CF$315
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10046-CH$315
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10046-CM$315
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10046-CY$315
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone)HG10046-M$115
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10046-M-F$315
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10046-NF$315
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10046-NH$315
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10046-NM$315
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10046-NY$315
Human SPARC-like 1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10046-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

SPARC-like protein 1 (SPARCL1; also known as SC1, high endothelial venule protein, or hevin) is an extracellular matrix-associated, secreted glycoprotein belonging to the secreted protein acidic and rich in cysteine (SPARC) family of matricellular proteins. It contains three conserved structural domains that are implicated in the regulation of cell adhesion, migration, and proliferation. SPARCL1 is expressed during embryogenesis and tissue remodeling and is especially prominent in brain and vasculature. Its down-regulation in a number of cancers and the possibility of its functional compensation by SPARC has led to recent interest in hevin as a tumor suppressor and regulator of angiogenesis. SPARCL1 has antiadhesive properties, and loss of SPARCL1 expression is associated with increased proliferative activity and cell cycle progression. It is suggested that it may influence multiple cellular processes during distinct stages of brain development and function. In addition, SPARCL1 can influence the function of astroglial cells in the developing and mature central nervous system (CNS).

  • Sullivan MM, et al. (2004) Hevin/SC1, a matricellular glycoprotein and potential tumor-suppressor of the SPARC/BM-40/Osteonectin family. Int J Biochem Cell Biol. 36(6): 991-6.
  • Esposito I, et al. (2007) Tumor-suppressor function of SPARC-like protein 1/Hevin in pancreatic cancer. Neoplasia. 9(1): 8-17.
  • Weimer JM, et al. (2008) A BAC transgenic mouse model to analyze the function of astroglial SPARCL1 (SC1) in the central nervous system. Glia. 56(9): 935-41.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items