Quick Order

Text Size:AAA

Human CD309 / VEGFR2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
KDRcDNA Clone Product Information
cDNA Size:4110
cDNA Description:ORF Clone of Homo sapiens kinase insert domain receptor (a type I II receptor tyrosine kinase) DNA.
Gene Synonym:KDR, FLK1, CD309, VEGFR, VEGFR2
Restriction Site:KpnI + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Vascular Endothelial Growth Factor (VEGF) & Receptor Related Products
Product nameProduct name
Cynomolgus Neuropilin-1 / NRP1 Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 ProteinHuman VEGFR1 / FLT-1 Protein (Fc Tag)Human PIGF / PLGF Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 / CD304 Protein (His Tag)Human VEGF121 / VEGF-A ProteinHuman Neuropilin-1 / NRP1 Protein (Fc Tag)Human Neuropilin-1 / NRP1 / CD304 Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His & GST Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human VEGF-C Protein (His Tag)Human VEGF-D / VEGFD / FIGF Protein (His Tag)Human Neuropilin 2 / NRP2 Protein (Fc Tag)Human Neuropilin-2 / NRP2 Protein (His Tag)Human VEGFR3 / FLT4 Protein (Fc Tag)Human VEGFR3 / FLT4 Protein (His Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human / Cynomolgus VEGF / VEGFA / VEGF165 ProteinHuman / Cynomolgus VEGF / VEGFA / VEGF165 ProteinHuman VEGF-B / VEGFB Protein (Fc Tag)Human VEGF121 / VEGF-A ProteinHuman VEGF121b / VEGF-A ProteinMouse PIGF / PLGF Protein (Fc Tag)Mouse PIGF / PLGF ProteinMouse VEGF-D / VEGFD / FIGF Protein (Fc Tag)Mouse VEGF-D / VEGFD / FIGF Protein (His Tag)Mouse VEGFA / VEGF164 ProteinMouse VEGFR3 / FLT-4 Protein (Fc Tag)Mouse VEGFR3 / FLT-4 Protein (His Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Danio rerio (zebrafish) VEGF / VEGFA / VEGF165 ProteinCanine VEGF / VEGFA ProteinRat VEGF164 / VEGFA ProteinRat VEGFR1 / FLT-1 Protein (His Tag)Rat VEGFC / VEGF-C Protein (aa 108-223, Fc Tag)Rat VEGFC / VEGF-C Protein (aa 108-223, His Tag)Rat VEGF-D / VEGFD / FIGF Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)

VEGFR2, also called as KDR or Flk-1, is identified as the receptor for VEGF and VEGFC and an early marker for endothelial cell progenitors, whose expression is restricted to endothelial cells in vivo. VEGFR2 was shown to be the primary signal transducer for angiogenesis and the development of pathological conditions such as cancer and diabetic retinopathy. It has been shown that VEGFR2 is expressed mainly in the endothelial cells, and the expression is upregulated in the tumor vasculature. Thus the inhibition of VEGFR2 activity and its downstream signaling are important targets for the treatment of diseases involving angiogenesis. VEGFR2 transduces the major signals for angiogenesis via its strong tyrosine kinase activity. However, unlike other representative tyrosine kinase receptors, VEGFR2 does not use the Ras pathway as a major downstream signaling but rather uses the phospholipase C-protein kinase C pathway to signal mitogen-activated protein (MAP)-kinase activation and DNA synthesis. VEGFR2 is a direct and major signal transducer for pathological angiogenesis, including cancer and diabetic retinopathy, in cooperation with many other signaling partners; thus, VEGFR2 and its downstream signaling appear to be critical targets for the suppression of these diseases. VEGF and VEGFR2-mediated survival signaling is critical to endothelial cell survival, maintenance of the vasculature and alveolar structure and regeneration of lung tissue. Reduced VEGF and VEGFR2 expression in emphysematous lungs has been linked to increased endothelial cell death and vascular regression.

  • Shibuya M. (2006) Vascular endothelial growth factor (VEGF)-Receptor2: its biological functions, major signaling pathway, and specific ligand VEGF-E. Endothelium. 13(2): 63-9.
  • Marwick JA, et al. (2010) Cigarette smoke regulates VEGFR2-mediated survival signaling in rat lungs. J Inflamm (Lond). 7(1): 11.
  • Bruns AF, et al. (2010) Ligand-stimulated VEGFR2 signaling is regulated by co-ordinated trafficking and proteolysis. Traffic. 11(1): 161-74.
  • Size / Price
    List Price: $445.00  (Save $0.00)
    Price:$445.00      [How to order]
    Availability5 Business days
    • Human CD309 / VEGFR2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged