After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Ferret TREM1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TREM1cDNA Clone Product Information
Gene_bank_ref_id:XM_004739942.1
cDNA Size:615
cDNA Description:ORF Clone of Mustela putorius furo (sub-species: furo) triggering receptor expressed on myeloid cells 1 DNA.
Gene Synonym:TREM1
Species:Ferret
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

TREM1 (triggering receptor expressed on myeloid cells) is a type I  transmembrane protein with a single Ig-like domain, and is selectively expressed on blood neutrophils and a subset of monocytes. As a member of the growing family of receptors related to NK cell receptors, TREM1 activates downstream signaling events with the help of an adapter protein called DAP12. Expression of TREM1 is up-regulated by bacterial LPS, a ligand for TLR4, as well as lipoteichoic acid. Although its natural ligand has not been identified, engagement of TREM1 with agonist mAbs triggers secretion of the proinflammatory cytokines TNF-α and IL-1β, as well as chemokines such as IL-8 and monocyte chemoattractant protein (MCP)-1. Intracellularly, TREM1 induces Ca2+ mobilization and tyrosine phosphorylation of extracellular signal-related kinase 1 (ERK1), ERK2 and phospholipase C-γ. In an animal model of LPS-induced septic shock, blockade of TREM1 signaling inhibited hyperresponsiveness and death. Thus, it has been demonstrated that TREM1 performs a critical function in immune responses involved in host defense against microbial challenges, and is suggested to be a potential therapeutic target for septic shock.

References
  • Bouchon, A. et al., 2000, J. Immunol. 164: 4991-4995.
  • Bouchon, A. et al., 2001, Nature. 410: 1103-1107.
  • Bleharski, J.R. et al., 2003, J. Immunol. 170: 3812-3818.
  • Size / Price
    Catalog:FG60048-CF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"