After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Canine CMPK1 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Canine CMPK1 cDNA Clone Product Information
Gene_bank_ref_id:XM_847756.4
RefSeq ORF Size:687bp
cDNA Description:Full length Clone DNA of Canis lupus familiaris cytidine monophosphate (UMP-CMP) kinase 1, cytosolic with C terminal Flag tag.
Gene Synonym:CMPK
Species:Canine
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

CMPK1 plays a key role in the maintenance of pyrimidine nucleotide pool profile and for the metabolism of pyrimidine analogs in cells. It catalyzes the phosphoryl transfer from ATP to UMP, CMP, and deoxy-CMP (dCMP), resulting in the formation of ADP and the corresponding nucleoside diphosphate. CMPK1 also has a significant role in the activation of pyrimidine analogs, which are clinically useful anti-cancer and anti-viral drugs. In the meanwhile, CMPK1 functions in cellular nucleic acid biosynthesis.

References
  • Liou J, et al. (2004) Phosphorylation of Cytidine, Deoxycytidine, and Their Analog Monophosphates by Human UMP/CMP Kinase is Differentially Regulated by ATP and Magnesium. Molecular Pharmacology. 67(3):806-14.
  • Gerhard DS, et al. (2004) The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC). Genome Research. 14(10B):2121-7.
  • Segura-Pena D, et al. (2004) Substrate-induced Conformational Changes in Human UMP/CMP Kinase. Journal of Biological Chemistry. 279(32):33882-9.
  • Size / Price
    Catalog: DG70228-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"