Quick Order

Human INT11/CPSF3L Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CPSF3L cDNA Clone Product Information
NCBI RefSeq:NM_017871.5
RefSeq ORF Size:1803bp
cDNA Description:Full length Clone DNA of Homo sapiens cleavage and polyadenylation specific factor 3-like.
Gene Synonym:RC68, INT11, RC-68, INTS11, CPSF73L
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CPSF3L qPCR primers for gene expression analysis, HP104956 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"