After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PRICKLE2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PRICKLE2 cDNA Clone Product Information
Gene_bank_ref_id:BC119002
RefSeq ORF Size:2535bp
cDNA Description:Full length Clone DNA of Homo sapiens prickle homolog 2 (Drosophila).
Gene Synonym:EPM5
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-PRICKLE2
Restriction Site:KpnI + XbaI (6.1kb + 2.54kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PRICKLE2 Gene Plasmid Map
Human PRICKLE2 natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Catalog: HG15965-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"