After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ADH7 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ADH7 cDNA Clone Product Information
Gene_bank_ref_id:BC131512
RefSeq ORF Size:1161bp
cDNA Description:Full length Clone DNA of Homo sapiens alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide.
Gene Synonym:ADH4
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Calcium/calmodulin-dependent protein kinase type I I subunit alpha, also known as CaM kinase II subunit alpha, CAMKA, and CAMK2A, is a member of the protein kinase superfamily, CAMK Ser/Thr protein kinase family, and CaMK subfamily. CAMK2A contains one protein kinase domain. CAMK2 is a prominent kinase in the central nervous system that may function in long-term potentiation and neurotransmitter release. As a member of the NMDAR signaling complex in excitatory synapses, it may regulate NMDAR-dependent potentiation of the AMPAR and synaptic plasticity. CAMK2 is composed of four different chains: alpha, beta, gamma, and delta. The different isoforms assemble into homo- or heteromultimeric holoenzymes composed of 8 to 12 subunits. CAMK2 interacts with BAALC, MPDZ, SYN1, CAMK2N2 and SYNGAP1.

References
  • Nagase T., et al., 1999, DNA Res. 6: 63-70.
  • Schmutz J., et al., 2004, Nature. 431: 268-274.
  • Krapivinsky G., et al., 2004, Neuron 43:563-574. 
  • Ignotz,GG. et al., 2005, Biol Reprod. 73 (3): 519-26.
  • Size / Price
    Catalog: HG15947-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"