After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GOT1cDNA Clone Product Information
Gene_bank_ref_id:NM_001284930.1
cDNA Size:1242
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) Aspartate aminotransferase, cytoplasmic DNA.
Gene Synonym:cCAT, cAspAT
Species:Cynomolgus
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90649-ACG$325
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90649-ACR$325
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90649-ANG$325
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90649-ANR$325
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90649-CF$295
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90649-CH$295
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90649-CM$295
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90649-CY$295
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone)CG90649-G$95
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90649-NF$295
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90649-NH$295
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90649-NM$295
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90649-NY$295
Cynomolgus monkey GOT1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90649-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Aspartate aminotransferase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and mitochondrial forms, aspartate aminotransferase and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. There is a rare in-frame deletion in aspartate aminotransferase gene, which inactivates cytosolic aspartate aminotransferase(cAST) enzyme in the Old Order Amish. This may help to understand structure and function of the enzyme and would be useful for predicting serum aspartate AST levels.

References
  • Shen H, et al. (2011) Genome-wide association study identifies genetic variants in GOT1 determining serum aspartate aminotransferase levels. J Hum Genet. 56(11):801-5.
  • Doonan S, et al. (1985) Structural and genetic relationships between cytosolic and mitochondrial isoenzymes. Int J Biochem. 16(12):1193-9.
  • Panteghini M. (1990) Aspartate aminotransferase isoenzymes. Clin Biochem. 23(4):311-9.
  • Bousquet-Lemercier B, et al. (1990) Properties of human liver cytosolic aspartate aminotransferase mRNAs generated by alternative polyadenylation site selection. Biochemistry. 29(22):5293-9.
  • Size / Price
    Catalog:CG90649-CF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"