Quick Order

Text Size:AAA

Cynomolgus monkey PLXDC1 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus PLXDC1 cDNA Clone Product Information
Gene_bank_ref_id:XM_005583997.1
RefSeq ORF Size:1503bp
cDNA Description:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) plexin domain containing 1 with C terminal Flag tag.
Gene Synonym:PLXDC1
Species:Cynomolgus
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Plexin domain-containing protein 1, also known as tumor endothelial marker 3, tumor endothelial marker 7 and PLXDC1 and TEM3, is a secreted, cytoplasm and single-pass type I membrane protein which belongs to the plexin family. PLXDC1 / TEM3 is detected in endothelial cells from colorectal cancer, and in endothelial cells from primary cancers of the lung, liver, pancreas, breast and brain. It is expressed in fibrovascular membrane with increased expression in individuals with proliferative diabetic retinopathy. PLXDC1 / TEM3 is not detectable in endothelial cells from normal tissue. PLXDC1 / TEM3 plays a critical role in endothelial cell capillary morphogenesis. PLXDC1 / TEM3 may play a significant role in the proliferation and maintenance of neovascular endothelial cells in the formation of fibrovascular membranes (FVMs). PLXDC1 / TEM3 may be a molecular target for new diagnostic and therapeutic strategies for proliferative diabetic retinopathy (PDR). PLXDC1 / TEM3 interacts with NID1. It may also interact with CTTN.

References
  • Beaty,R.M. et al., 2007,J Neurooncol. 81 (3):241-8.
  • Miller,S.F. et al., 2007, Gene Expr Patterns. 7 (5):635-44.
  • Yamaji,Y. et al., 2008, Invest Ophthalmol Vis Sci. 49 (7):3151-7.
  • Size / Price
    Catalog: CG90635-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"