Quick Order

Cynomolgus monkey LOC101926125 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LOC101926125cDNA Clone Product Information
cDNA Size:519
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101926125 DNA.
Gene Synonym:LOC101926125
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Cynomolgus monkey LOC101926125 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Cynomolgus monkey LOC101926125 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90622-ACG$325
Cynomolgus monkey LOC101926125 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90622-ACR$325
Cynomolgus monkey LOC101926125 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90622-ANG$325
Cynomolgus monkey LOC101926125 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90622-ANR$325
Cynomolgus monkey LOC101926125 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90622-CF$295
Cynomolgus monkey LOC101926125 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90622-CH$295
Cynomolgus monkey LOC101926125 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90622-CM$295
Cynomolgus monkey LOC101926125 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90622-CY$295
Cynomolgus monkey LOC101926125 Gene cDNA Clone (full-length ORF Clone)CG90622-G$95
Cynomolgus monkey LOC101926125 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90622-NF$295
Cynomolgus monkey LOC101926125 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90622-NH$295
Cynomolgus monkey LOC101926125 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90622-NM$295
Cynomolgus monkey LOC101926125 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90622-NY$295
Cynomolgus monkey LOC101926125 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90622-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks