Quick Order

Text Size:AAA

Cynomolgus monkey CTRL ORF mammalian expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus CTRL cDNA Clone Product Information
NCBI RefSeq:XM_005592301.1
RefSeq ORF Size:795bp
cDNA Description:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) chymotrypsin-like with C terminal Flag tag.
Gene Synonym:CTRL
Species:Cynomolgus
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

CTRL-1, also known as chymotrypsin-like protease, belongs to the peptidase S1 family. CTRL-1 contains 1 peptidase S1 domain. Its expression is increased in preeclampsia (PE). Placental-derived chymotrypsin-like protease is responsible for inducing endothelial inflammatory phenotypic changes possibly by upregulation of cell adhesion molecule expressions, activation of cellular protease, and induction of extracellular regulated kinase phosphorylation. Activated microglia have been observed in various neurodegenerative diseases, including Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis, and multiple sclerosis. Five structurally distinct inhibitors that are known to inhibit chymotrypsin-like proteases were partially protective. They might represent a novel class of drugs with benefit in diseases where overactivity of microglia contributes to the pathogenesis.

References
  • Yang Gu. et al., 2009, Reprod Sci. 16 (9): 905-13.
  • Klegeris A. et al., 2005, Glia. 51 (1):56-64.
  • Caroline V. Bamford. et al., 2007, nfect Immun. 75 (9): 4364-72.
  • Size / Price
    Catalog: CG90549-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"