Quick Order

Text Size:AAA

Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HSP90AA1cDNA Clone Product Information
cDNA Size:2202
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) heat shock protein 90kDa alpha (cytosolic), class A member 1 DNA.
Gene Synonym:HSP90AA1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90401-ACG$345
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90401-ACR$345
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90401-ANG$345
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90401-ANR$345
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90401-CF$315
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90401-CH$315
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90401-CM$315
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90401-CY$315
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone)CG90401-G$195
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90401-NF$315
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90401-NH$315
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90401-NM$315
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90401-NY$315
Cynomolgus monkey HSP90AA1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90401-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

Heat shock protein 90 (90 kDa heat-shock protein, HSP90) is a molecular chaperone involved in the trafficking of proteins in the cell. It is a remarkably versatile protein involved in the stress response and in normal homoeostatic control mechanisms. HSP90 interacts with 'client proteins', including protein kinases, transcription factors and others, and either facilitates their stabilization and activation or directs them for proteasomal degradation. By this means, HSP90 displays a multifaceted ability to influence signal transduction, chromatin remodelling and epigenetic regulation, development and morphological evolution. HSP90 operates as a dimer in a conformational cycle driven by ATP binding and hydrolysis at the N-terminus. Disruption of HSP90 leads to client protein degradation and often cell death. Under stressful conditions, HSP90 stabilizes its client proteins and provides protection to the cell against cellular stressors such as in cancer cells. Especially, several oncoproteins act as HSP90 client proteins and tumor cells require higher HSP90 activity than normal cells to maintain their malignancy. For this reason, Hsp90 has emerged as a promising target for anti-cancer drug development.

  • Pearl LH, et al. (2008) The Hsp90 molecular chaperone: an open and shut case for treatment. Biochem J. 410(3): 439-53.
  • Hahn JS. (2009) The Hsp90 chaperone machinery: from structure to drug development. BMB Rep. 42(10): 623-30.
  • Holzbeierlein JM, et al. (2010) Hsp90: a drug target? Curr Oncol Rep. 12(2): 95-101.
  • Trepel J, et al. (2010) Targeting the dynamic HSP90 complex in cancer. Nat Rev Cancer. 10(8): 537-49.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items