After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human GPD1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GPD1 cDNA Clone Product Information
NCBI RefSeq:BC032234
RefSeq ORF Size:1050bp
cDNA Description:Full length Clone DNA of Homo sapiens glycerol-3-phosphate dehydrogenase 1 (soluble).
Gene Synonym:GPD-C, HTGTI, GPDH-C
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

GPD1, also known as glycerolphosphate dehydrogenase 1, is a member of the NAD-dependent glycerol-3-phosphate dehydrogenase family. GPD1 catalyzes the reversible redox conversion of dihydroxyacetone phosphate (DHAP), thus plays a critical role in carbohydrate and lipid metabolism. It also reduces nicotine adenine dinucleotide (NADH) to glycerol-3-phosphate (G3P) and NAD+. Meanwhile, GPD1 and mitochondrial glycerol-3-phosphate dehydrogenase also form a glycerol phosphate shuttle that facilitates the transfer of reducing equivalents from the cytosol to mitochondria. Mutations in GPD1 gene are a cause of transient infantile hypertriglyceridemia.

References
  • Ou X. et al., 2006, J Mol Biol. 357 (3): 858-69.
  • Ou Xianjin. et al., 2011, Journal of Molecular Biology. 357 (3): 858-69.
  • Harding Jr. et al., 1975, Biochem Journal. 146: 223-9.
  • Size / Price
    Catalog: HG15489-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"