Quick Order

Human ING5 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ING5 cDNA Clone Product Information
Gene_bank_ref_id:NM_032329.4
RefSeq ORF Size:723bp
cDNA Description:Full length Clone DNA of Homo sapiens inhibitor of growth family, member 5 DNA.
Gene Synonym:p28ING5
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

ING5 belongs to the ING family. It contains 1 PHD-type zinc finger and is a component of the HBO1 complex. HBO1 complex has a histone H4-specific acetyltransferase activity, a reduced activity toward histone H3 and is responsible for the bulk of histone H4 acetylation in vivo. HBO1 complex composed at least of ING4 or ING5, KAT7/HBO1, MEAF6, and one of PHF15, PHF16 and PHF17. ING5 also is a component of the MOZ/MORF complex which is composed at least of ING5, KAT6A, KAT6B, MEAF6 and one of BRPF1, BRD1/BRPF2 and BRPF3. It interacts with EP300 and TP53. MOZ/MORF complex has a histone H3 acetyltransferase activity. Through chromatin acetylation ING5 may regulate DNA replication and may function as a transcriptional coactivator. It interacts with H3K4me3 and to a lesser extent with H3K4me2. ING5 is similar to ING1, a tumor suppressor protein that can interact with TP53, inhibit cell growth, and induce apoptosis. It can bind TP EP300/p300, a component of the histone acetyl transferase complex, suggesting its involvement in TP53-dependent regulatory pathway.

References
  • Zhang F, et al. (2011) The inhibitor of growth protein 5 (ING5) depends on INCA1 as a co-factor for its antiproliferative effects. PLoS One. (7):e21505.
  • Zheng HC, et al. (2011) The nuclear to cytoplasmic shift of ING5 protein during colorectal carcinogenesis with their distinct links to pathologic behaviors of carcinomas. Hum Pathol. 42(3):424-33.
  • Xing YN, et al. (2011) The altered expression of ING5 protein is involved in gastric carcinogenesis and subsequent progression. Hum Pathol. 42(1):25-35.
  • Size / Price
    Catalog: HG15462-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"