Quick Order

Cynomolgus monkey TLR4 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus TLR4 cDNA Clone Product Information
Gene_bank_ref_id:NM_001037092.1
RefSeq ORF Size:2481bp
cDNA Description:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) toll-like receptor 4 with C terminal Flag tag.
Gene Synonym:hToll, TLR4
Species:Cynomolgus
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

TLR4, also known as TLR-4, is a member of the Toll-like receptor (TLR) family, which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. TLR4 is most abundantly expressed in placenta, and in myelomonocytic subpopulation of the leukocytes. TLR 4 has also been designated as CD284 (cluster of differentiation 284). It has been implicated in signal transduction events induced by lipopolysaccharide (LPS) found in most gram-negative bacteria. TLR4 Cooperates with LY96 and CD14 to mediate the innate immune response to bacterial lipopolysaccharide (LPS). It acts via MYD88, TIRAP and TRAF6, leading to NF-kappa-B activation, cytokine secretion and the inflammatory response. It is also involved in LPS-independent inflammatory responses triggered by Ni(2+).

References
  • Re, Fabio, et al. (2002) Monomeric recombinant MD-2 binds toll-like receptor 4 tightly and confers lipopolysaccharide responsiveness. J Biol Chem. 277(26):23427-32.
  • Shimazu, R, et al. (1999) MD-2, a Molecule that Confers Lipopolysaccharide Responsiveness on Toll-like Receptor 4. J Exp Med. 189(11):1777-82.
  • Blanco, A M, et al. (2005) Involvement of TLR4/type I IL-1 receptor signaling in the induction of inflammatory mediators and cell death induced by ethanol in cultured astrocytes. Journal of immunology. 175(10):6893-9.
  • Size / Price
    Catalog: CG90258-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"