After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey SIRPG Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SIRPGcDNA Clone Product Information
cDNA Size:1164
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) signal-regulatory protein gamma DNA.
Gene Synonym:SIRPG
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Signal-regulatory protein gamma (SIRPG/SIRP gamma) also known as CD172 antigen-like family member B, CD172g, and CD172g antigen, is a member of the signal-regulatory protein (SIRP) family, and also belongs to the immunoglobulin superfamily. SIRP family members are receptor-type transmembrane glycoproteins known to be involved in the negative regulation of receptor tyrosine kinase-coupled signaling processes. SIRPG/SIRP gamma/CD172g is probable immunoglobulin-like cell surface receptor. On binding with CD47, SIRPG can mediate cell-cell adhesion. SIRPG/SIRP gamma is engagement on T-cells by CD47 on antigen-presenting cells results in enhanced antigen-specific T-cell proliferation and costimulates T-cell activation. SIRPG/SIRP gamma/CD172g is detected in liver, and at very low levels in brain, heart, lung, pancreas, kidney, placenta and skeletal muscle. Expressed on CD4+ T-cells, CD8+ T-cells, CD56-bright natural killer (NK) cells, CD20+ cells, and all activated NK cells. This cytokine is mainly present in the paracortical T-cell area of lymph nodes, with only sparse positive cells in the mantle and in the germinal center of B-cell follicles. In the thymus, SIRPG is primarily expressed in the medulla on mature T-lymphocytes that have undergone thymic selection.

  • Meador JA, et al. (2011) p53-independent downregulation of histone gene expression in human cell lines by high- and low-let radiation. Radiat Res. 175(6): 689-99.
  • Reddy MV, et al. (2011) Association between type 1 diabetes and GWAS SNPs in the southeast US Caucasian population. Genes Immun. 12(3): 208-12.
  • Kawasaki M, et al. (2009) Changes in the gene expression of peripheral blood mononuclear cells during the menstrual cycle of females is associated with a gender bias in the incidence of systemic lupus erythematosus. Clin Exp Rheumatol. 27(2): 260-6.