Quick Order

Human ARF5 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ARF5 cDNA Clone Product Information
Gene_bank_ref_id:BC003043
RefSeq ORF Size:543bp
cDNA Description:Full length Clone DNA of Homo sapiens ADP-ribosylation factor 5.
Gene Synonym:ARF5
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

ARF5, also known as ADP-ribosylation factor 5, belongs to the small GTPase superfamily, Arf family. Members of this family stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. ARF5 functions as an allosteric activator of the cholera toxin catalytic subunit, an ADP-ribosyltransferase. ARF5 Is involved in protein trafficking. ARF5 may also modulate vesicle budding and uncoating within the Golgi apparatus.

References
  • Kanoh H. et al., 1997, J Biol Chem. 272 (9): 5421-9.
  • Tsuchiya M. et al., 1991, J Biol Chem. 266 (5): 2772-7.
  • McGuire RE. et al., 1997, Genomics. 41 (3): 481-4.
  • Size / Price
    Catalog: HG14934-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"