After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CEBPG natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CEBPG cDNA Clone Product Information
Gene_bank_ref_id:BC007582
RefSeq ORF Size:453bp
cDNA Description:Full length Clone DNA of Homo sapiens CCAAT/enhancer binding protein (C/EBP), gamma.
Gene Synonym:GPE1BP, IG/EBP-1
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

CEBPG, also known as CEBP gamma, is a transcription factor which belongs to the CEBP family. Members of this family regulate viral and cellular CCAAT/enhancer element-mediated transcription. CEBP proteins contain the bZIP region, which is characterized by two motifs in the C-terminal half of the protein: a basic region involved in DNA binding and a leucine zipper motif involved in dimerization. CEBPG binds to the enhancer element PRE-I of the IL-4 gene. It Might change the DNA-binding specificity of other transcription factors and recruit them to unusual DNA sites.

References
  • Thomassin H. et al., 1992, Nucleic Acids Res. 20 (12): 3091-8.
  • Nishizawa M. et al., 1992, FEBS Lett. 299 (1): 36-8.
  • Williams SC. et al., 1991, Genes Dev. 5 (9): 1553-67.
  • Melchionna R. et al., 2012, J Invest Dermatol. 132 (7): 1908-17.
  • Size / Price
    Catalog: HG14925-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"