Quick Order

Human SHPK natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SHPK cDNA Clone Product Information
Gene_bank_ref_id:BC020543
RefSeq ORF Size:1437bp
cDNA Description:Full length Clone DNA of Homo sapiens sedoheptulokinase.
Gene Synonym:SHK, CARKL
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

CARKL, also known as SHPK, is a nonprotein kinase of glucose metabolism. CARKL has weak homology to several carbohydrate kinases, a class of proteins involved in the phosphorylation of sugars as they enter a cell, inhibiting return across the cell membrane. CARKL catalyzes an orphan reaction in the pentose phosphate pathway, refocusing cellular metabolism to a high-redox state upon physiological or artificial downregulation. CARKL-dependent metabolic reprogramming is required for proper M1- and M2-like macrophage polarization and uncover a rate-limiting requirement for appropriate glucose flux in macrophage polarization.

References
  • Haschemi A. et al., 2012, Cell Metab. 15 (6): 813-26.
  • Udeshi ND. et al., 2012, Mol Cell Proteomics. 11 (5): 148-59.
  • Wamelink MM. et al., 2008, Hum Mutat. 29 (4): 532-6.
  • Size / Price
    Catalog: HG14833-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"