After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human ETHE1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ETHE1 cDNA Clone Product Information
Gene_bank_ref_id:BC008250
RefSeq ORF Size:765bp
cDNA Description:Full length Clone DNA of Homo sapiens ethylmalonic encephalopathy 1.
Gene Synonym:HSCO, YF13H12
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

ETHE1, also known as HSCO, is a sulfur dioxygenase that localizes within the mitochondrial matrix. ETHE1 probably plays an important role in metabolic homeostasis in mitochondria. It may also function as a nuclear-cytoplasmic shuttling protein that binds transcription factor RELA/NFKB3 in the nucleus and exports it to the cytoplasm. ETHE1 can suppresses p53-induced apoptosis by preventing nuclear localization of RELA. Mutations in ETHE1 gene result in ethylmalonic encephalopathy. Ethylmalonic encephalopathy is an autosomal recessive, invariably fatal disorder characterized by early-onset encephalopathy, microangiopathy, chronic diarrhea, defective cytochrome c oxidase (COX) in muscle and brain, high concentrations of C4 and C5 acylcarnitines in blood and high excretion of ethylmalonic acid in urine.

References
  • Higashitsuji. et al., 2002, Cancer Cell. 2 (4): 335-46.
  • McCoy JG. et al., 2007, Acta Crystallogr D Biol Crystallogr. 62 (9): 964-70.
  • Mehrle A. et al., 2006, Nucleic Acids Res. 34: D415-8.
  • Size / Price
    Catalog: HG14681-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"