Quick Order

Human COMMD8 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human COMMD8 cDNA Clone Product Information
NCBI RefSeq:BC019826
RefSeq ORF Size:552bp
cDNA Description:Full length Clone DNA of Homo sapiens COMM domain containing 8.
Gene Synonym:COMMD8
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

COMMD8 is a member of the COMMD family. Members of this family are a group of evolutionary conserved proteins that share a common COMM domain at the extreme C-terminus, which provides an interface for protein-protein interactions. Most COMMD proteins play a role in the regulation of NF˚B and, despite their similarities, seem to function in unique and non-redundant pathways. COMMD proteins may also play a role in the function of epithelial sodium channels, cell proliferation, copper homeostasis and in the regulation of the ubiquitin pathway. COMMD8 also contains 1 COMM domain and is widely expressed with highest expression in thyroid.

References
  • Danielsen JM. et al., 2011, Mol Cell Proteomics. 10 (3): M110.003590.
  • Vinayagam A. et al., 2011, Sci Signal. 4 (189): rs8.
  • Havugimana PC. et al., 2012, Cell. 150 (5): 1068-81.
  • Size / Price
    Catalog: HG14666-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"