After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PSME2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PSME2 cDNA Clone Product Information
NCBI RefSeq:BC004368
RefSeq ORF Size:720bp
cDNA Description:Full length Clone DNA of Homo sapiens proteasome (prosome, macropain) activator subunit 2 (PA28 beta).
Gene Synonym:PA28B, REGbeta, PA28beta
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

PSME2, also known as PA28b, is a subunit of proteasome. The 26S proteasome multicatalytic proteinase complex has a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. PSME2 gene encodes the beta subunit of the 11S regulator, one of the two 11S subunits that is induced by gamma-interferon. Three beta and three alpha subunits combine to form a heterohexameric ring.

References
  • Ahn K. et al., 1996, J Biol Chem. 271 (30): 18237-42.
  • Rual Jean-François. et al., 2005, Nature. 437 (7062): 1173-8.
  • Ahn JY. et al., 1995, FEBS Lett. 366 (1): 37-42.
  • Size / Price
    Catalog: HG14640-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"