Quick Order

Human PMVK Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PMVKcDNA Clone Product Information
cDNA Size:579
cDNA Description:ORF Clone of Homo sapiens phosphomevalonate kinase DNA.
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

PMVK is a peroxisomal enzyme that catalyzes the conversion of mevalonate 5-phosphate into mevalonate 5-diphosphate, the fifth reaction of the cholesterol biosynthetic pathway. Studies in rat show that the message level and the enzyme activity of PMVK is regulated by sterol, and that this regulation is coordinated with 3-hydroxy-3-methylglutaryl coenzyme A reductase, the rate-limiting enzyme of cholesterol biosynthesis.

Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items