Quick Order

Text Size:AAA

Human DCTPP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DCTPP1cDNA Clone Product Information
cDNA Size:513
cDNA Description:ORF Clone of Homo sapiens dCTP pyrophosphatase 1 DNA.
Gene Synonym:CDA03, RS21C6, XTP3TPA
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

DCTPP1 hydrolyzes deoxynucleoside triphosphates (dNTPs) to the corresponding nucleoside monophosphates. It has a strong preference for modified dCTP. DCTPP1’s activity is highest with 5-iodo-dCTP, followed by 5-bromo-dCTP, unmodified dCTP, 5-methyl-dCTP and 5-chloro-dCTP. DCTPP1 also hydrolyzes 2-chloro-dATP and 2-hydroxy-dATP with lower efficiency, and has even lower activity with unmodified dATP, dTTP and dUTP (in vitro). DCTPP1 does not hydrolyze ATP, UTP, ITP, GTP, dADP, dCDP or dGTP. It may protect DNA or RNA against the incorporation of non-canonical nucleotide triphosphates. DCTPP1 may also protect cells against inappropriate methylation of CpG islands by DNA methyltransferases.

  • Stelzl U. et al., 2005, Cell. 122 (6): 957-68.
  • Strausberg RL. et al., 2003, Proc Natl Acad Sci. 99 (26): 16899-903.
  • Moroz OV. et al., 2005, J Mol Biol. 347 (2): 243-55.