After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human GCSH natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GCSH cDNA Clone Product Information
Gene_bank_ref_id:BC000790
RefSeq ORF Size:522bp
cDNA Description:Full length Clone DNA of Homo sapiens glycine cleavage system protein H (aminomethyl carrier).
Gene Synonym:GCE, NKH
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). GCSH is the H protein, which transfers the methylamine group of glycine from the P protein to the T protein. Defects in GCSH gene are a cause of nonketotic hyperglycinemia (NKH). Two transcript variants, one protein-coding and the other probably not protein-coding,have been found for GCSH gene. Also, several transcribed and non-transcribed pseudogenes of GCSH gene exist throughout the genome.

References
  • Hiraga K. et al., 1988, Biochem Biophys Res Commun. 151 (2): 758-62.
  • Fujiwara K. et al., 1991, Biochem Biophys Res Commun. 176 (2): 711-6.
  • Koyata H. et al., 1991, Am J Hum Genet. 48 (2): 351-61.
  • Size / Price
    Catalog: HG14568-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"