After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human LSM3 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human LSM3 cDNA Clone Product Information
NCBI RefSeq:BC007055
RefSeq ORF Size:309bp
cDNA Description:Full length Clone DNA of Homo sapiens LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae).
Gene Synonym:SMX4, USS2, YLR438C
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

LSM3 is a member of the snRNP Sm proteins family. Sm-like proteins can be detected in a variety of organisms. They all have the Sm sequence motif, which consists of 2 regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing. LSM3binds specifically to the 3'-terminal U-tract of U6 snRNA.

References
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Lehner B. et al., 2004, Genome Res. 14 (7): 1315-23.
  • Lehner B. et al., 2004, Genomics. 83 (1): 153-67.
  • Size / Price
    Catalog: HG14554-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"