Quick Order

Human CRABP1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CRABP1 cDNA Clone Product Information
Gene_bank_ref_id:BC022069
RefSeq ORF Size:414bp
cDNA Description:Full length Clone DNA of Homo sapiens cellular retinoic acid binding protein 1.
Gene Synonym:RBP5, CRABP, CRABPI, CRABP-I
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

CRABP1 is a specific binding protein for a vitamin A family member. It is thought that CRABP1 plays an important role in retinoic acid-mediated differentiation and proliferation processes. CRABP1 is structurally similar to the cellular retinol-binding proteins, but binds only retinoic acid at specific sites within the nucleus, which may contribute to vitamin A-directed differentiation in epithelial tissue. It forms a beta-barrel structure which accommodates hydrophobic ligands in its interior.

References
  • Wu Q. et al., 2007, Mol Cancer. 6: 45.
  • Tanaka K. et al., 2007, Oncogene. 26 (44): 6456-68.
  • Lind GE. et al., 2007, Cell Oncol. 28 (5-6): 259-72.
  • Size / Price
    Catalog: HG14511-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"