Quick Order

Text Size:AAA

Human PAX8 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PAX8 cDNA Clone Product Information
Gene_bank_ref_id:BC001060
RefSeq ORF Size:1353bp
cDNA Description:Full length Clone DNA of Homo sapiens paired box 8.
Gene Synonym:PAX8
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

PAX8 gene is a member of the paired box (PAX) family of transcription factors. Members of this gene family typically encode proteins which contain a paired box domain, an octapeptide, and a paired-type homeodomain. PAX8 is involved in thyroid follicular cell development and expression of thyroid-specific genes. Also functions in very early stages of kidney organogenesis. Mutations in PAX8 gene have been associated with thyroid dysgenesis, thyroid follicular carcinomas and atypical follicular thyroid adenomas. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.

References
  • Poleev A. et al., 1995, Eur J Biochem. 228 (3): 899-911
  • Poleev A. et al., 1993, Development. 116 (3): 611-23.
  • Di Palma. et al., 2003, J Biol Chem. 278 (5): 3395-402.
  • Size / Price
    Catalog: HG14505-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"