After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human KIAA0101 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human KIAA0101 cDNA Clone Product Information
NCBI RefSeq:BC005832
RefSeq ORF Size:336bp
cDNA Description:Full length Clone DNA of Homo sapiens KIAA0101.
Gene Synonym:L5, PAF, OEATC, PAF15, OEATC1, p15PAF, NS5ATP9, OEATC-1, p15/PAF, p15(PAF)
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

KIAA0101, also known as p15(PAF), is a proliferating cell nuclear antigen-associated factor which interacts with proliferating cell nuclear antigen(PCNA). It was initially isolated in a yeast two-hybrid screen for PCNA binding partners, and was shown to bind PCNA competitively with the cell cycle regulator p21(WAF). KIAA0101 is localized primarily in the nucleus. It shares the conserved PCNA binding motif with several other PCNA binding proteins including CDK inhibitor p21 . KIAA0101 is involved in cell proliferation and plays a role in early tumor recurrence (ETR), and prognosis of hepatocellular carcinoma (HCC). KIAA0101 is expressed predominantly in liver, pancreas and placenta. It cannot be detected in heart or brain. It is highly expressed in a number of tumors, especially esophageal tumors, in anaplastic thyroid carcinomas and in non-small-cell lung cancer lines. Overexpression of KIAA0101 predicts high stage, early tumor recurrence, and poor prognosis of hepatocellular carcinoma. It also may be involved in protection of cells from UV-induced cell death.

References
  • Yu P, et al. (2001) p15(PAF), a novel PCNA associated factor with increased expression in tumor tissues. Oncogene. 20 (4): 484-9.
  • Simpson F, et al. (2005) The PCNA-associated factor KIAA0101/p15(PAF) binds the potential tumor suppressor product p33ING1b. Exp Cell Res. 312 (1): 73-85.
  • Guo M, et al. (2006) KIAA0101 (OEACT-1), an expressionally down-regulated and growth-inhibitory gene in human hepatocellular carcinoma. BMC Cancer. 6: 109.
  • Nagase T, et al. (1995) Prediction of the coding sequences of unidentified human genes. III. The coding sequences of 40 new genes (KIAA0081-KIAA0120) deduced by analysis of cDNA clones from human cell line KG-1. DNA Res. 2 (1): 37-43.
  • Size / Price
    Catalog: HG14486-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"