After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human OPTN natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human OPTN cDNA Clone Product Information
NCBI RefSeq:BC013876
RefSeq ORF Size:1734bp
cDNA Description:Full length Clone DNA of Homo sapiens optineurin.
Gene Synonym:NRP, FIP2, HIP7, HYPL, ALS12, GLC1E, TFIIIA-INTP
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Optineurin gene encodes the coiled-coil containing protein optineurin. Optineurin may play a role in normal-tension glaucoma and adult-onset primary open angle glaucoma. Optineurin interacts with adenovirus E3-14.7K protein and may utilize tumor necrosis factor-alpha or Fas-ligand pathways to mediate apoptosis, inflammation or vasoconstriction. Optineurin may also function in cellular morphogenesis and membrane trafficking, vesicle trafficking, and transcription activation through its interactions with the RAB8, huntingtin, and transcription factor IIIA proteins. Alternative splicing results in multiple transcript variants encoding the same protein.

References
  • Rezaie T. et al., 2002, Science. 295 (5557): 1077-9.
  • Li Y. et al., 1998, Mol Cell Biol. 18 (3): 1601-10.
  • Skarnes Wc RB. et al., 2011, Nature. 474 (7351): 337-42.
  • Size / Price
    Catalog: HG14478-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"