After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human RIOK1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RIOK1cDNA Clone Product Information
Gene_bank_ref_id:BC006104
cDNA Size:1707
cDNA Description:ORF Clone of Homo sapiens RIO kinase 1 DNA.
Gene Synonym:AD034, RRP10, bA288G3.1
Species:Human
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

RIOK1, also known as RIO kinase 1, is a member of the RIO family of atypical serine protein kinases first characterized in yeast. RIOK1 and RIOK2 proteins are present in organisms from Archaea to humans. RIOK1 functios as a new interactor of protein arginine methyltransferase 5 (PRMT5), competes with pICln for binding and modulates PRMT5 complex composition and substrate specificity. RioK1 and pICln bind to PRMT5 in a mutually exclusive fashion. This results in a PRMT5-WD45/MEP50 core structure that either associates with pICln or RioK1 RIOK1 in distinct complexes. RIOK1 functions in analogy to pICln as an adapter protein by recruiting the RNA-binding protein nucleolin to the PRMT5 complex for its symmetrical methylation.

References
  • Widmann B. et al., 2012, Mol Biol Cell. 23 (1): 22-35.
  • LaRonde-LeBlanc N. et al., 2005, Biochim Biophys Acta. 1754 (1-2): 14-24.
  • Guderian G. et al., 2011, J Biol Chem. 286 (3): 1976-86.
  • Size / Price
    Catalog:HG14477-UT
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"