After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ABHD10 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ABHD10 cDNA Clone Product Information
Gene_bank_ref_id:BC014516
RefSeq ORF Size:921bp
cDNA Description:Full length Clone DNA of Homo sapiens abhydrolase domain containing 10.
Gene Synonym:ABHD10
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Mycophenolic acid (MPA), the active metabolite of the immunosuppressant mycophenolate mofetil (MMF), is primarily metabolized by glucuronidation to a phenolic glucuronide (MPAG) and an acyl glucuronide (AcMPAG). It is known that AcMPAG, which may be an immunotoxic metabolite, is deglucuronidated in human liver. AcMPAG deglucuronidation activity was detected in both human liver cytosol (HLC) and microsomes (HLM). By purification from HLC with column chromatographic purification steps, the enzyme responsible for AcMPAG deglucuronidationis identified as α/β hydrolase domain containing 10 (ABHD10). Recombinant ABHD10 expressed in Sf9 cells efficiently deglucuronidated AcMPAG with a K(m) value of 100.7 ± 10.2 μM, which was similar to those in HLM, HLC, and human liver homogenates (HLH). Immunoblot analysis revealed ABHD10 protein expression in both HLC and HLM. The AcMPAG deglucuronidation by recombinant ABHD10, HLC, and HLH were potently inhibited by AgNO(3), CdCl(2), CuCl(2), PMSF, bis-p-nitrophenylphosphate, and DTNB. The CL(int) value of AcMPAG formation from MPA, which was catalyzed by human UGT2B7, in HLH was increased by 1.8-fold in the presence of PMSF. Thus, human ABHD10 would affect the formation of AcMPAG, the immunotoxic metabolite.

References
  • Nardini M. et al., 1999, Curr Opin Struct Biol. 9 (6): 732-7.
  • Carr PD. et al., 2009, Protein Pept Lett. 16 (10): 1137-48.
  • Cheah E. et al., 1992, Protein Eng. 5 (3): 197-211.
  • Iwamura A. et al., 2012, J Biol Chem. 287 (12): 9240-9.
  • Size / Price
    Catalog: HG14439-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"