Quick Order

Text Size:AAA

Human GADD45G natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GADD45G cDNA Clone Product Information
Gene_bank_ref_id:BC000465
RefSeq ORF Size:480bp
cDNA Description:Full length Clone DNA of Homo sapiens growth arrest and DNA-damage-inducible, gamma.
Gene Synonym:RP11-260L6.1, CR6, DDIT2, GADD45gamma, GRP17, GADD45G
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

GADD45G, also known as CR6, is part of the nuclear proteins to interact with various proteins whose transcript levels are raised after stressful growth arrest conditions and treatment with DNA-damaging agents. GADD45G reacts to environmental stresses by mediating activation of the p38/JNK pathway which is mediated through their protein binding and activating MTK1/MEKK4 kinase, which is an upstream activator of both p38 and JNK MAPKs. GADD45G acts as a new-age tumor suppressor however is being frequently inactivated epigenetically in multiple tumors. GADD45G mRNA expression is down-regulated in hepatocellular carcinoma. GADD45G causes cell cycle arrest at G2/M transition when transfected into Hep-G2 cells. GADD45G induction by androgens involves new protein synthesis. Overexpression of GADD45G inhibits cell growth and causes morphological modifications in prostate cell lines thus GADD45G takes part in differentiation induction by androgens.

References
  • Takekawa M. et al., 1998, Cell. 95 (4): 521-30.
  • Suzuki M. et al., 1999, J Hum Genet. 44 (5): 300-3.
  • Azam N. et al., 2001, J Biol Chem. 276 (4): 2766-74.
  • Size / Price
    Catalog: HG14379-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"