After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human GGCT natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GGCT cDNA Clone Product Information
Gene_bank_ref_id:BC000625
RefSeq ORF Size:567bp
cDNA Description:Full length Clone DNA of Homo sapiens gamma-glutamylcyclotransferase.
Gene Synonym:C7orf24, CRF21, FLJ11717, GCTG, GGC, MGC3077, GGCT
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

GGCT belongs to the gamma-glutamylcyclotransferase family. It catalyzes the formation of 5-oxoproline from gamma-glutamyl dipeptides, the penultimate step in glutathione catabolism. GGCT may play a significant role in glutathione homeostasis. GGCT also induces release of cytochrome c from mitochondria with resultant induction of apoptosis. Pseudogenes of GGCT gene are located on the long arm of chromosome 5 and the short arm of chromosomes 2 and 20. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

References
  • Wagner SA. et al., 2011, Mol Cell Proteomics. 10 (10): M111.013284.
  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Amano T. et al., 2012, J Histochem Cytochem. 60 (1): 76-86.
  • Size / Price
    Catalog: HG14366-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"