Quick Order

Human RRM1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RRM1cDNA Clone Product Information
Gene_bank_ref_id:BC006498
cDNA Size:2379
cDNA Description:ORF Clone of Homo sapiens ribonucleotide reductase M1 DNA.
Gene Synonym:R1, RIR1, RR1, RRM1
Species:Human
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

RRM1 is a subunit of ribonucleoside-diphosphate reductase which is constituted by two subunits. Ribonucleoside-diphosphate reductase is an enzyme essential for the production of deoxyribonucleotides prior to DNA synthesis in S phase of dividing cells. RRM1 is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. RRM1 may play a role in malignancies and disease that involve this region.

References
  • Pitterle DM, et al. (1999) Human gene for the large subunit of ribonucleotide reductase (RRM1): functional analysis of the promoter. Genomics. 27(2):280-5.
  • Parker NJ, et al. (1995) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Gautam A, et al. (2003) RRM1-induced metastasis suppression through PTEN-regulated pathways. Oncogene. 22(14):2135-42.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"