Quick Order

Text Size:AAA

Human ECD natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ECD cDNA Clone Product Information
Gene_bank_ref_id:BC000721
RefSeq ORF Size:1935bp
cDNA Description:Full length Clone DNA of Homo sapiens ecdysoneless homolog (DrosophilA).
Gene Synonym:GCR2, HSGT1, ECD
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

ECD, also known as ecdysoneless homolog, belongs to the SGT1 family. It is highly expressed in muscle and heart. ECD is a novel promoter of mammalian cell cycle progression. This function is related to its ability to remove the repressive effects of Rb-family tumor suppressors on E2F transcription factors. It is a novel tumor-promoting factor that is differentially expressed in pancreatic cancer and potentially regulates glucose metabolism within cancer cells. ECD may also be a transcriptional activator required for the expression of glycolytic genes.

References
  • Badzek S. et al., 2011, Wien Klin Wochenschr. 123 (23-24): 726-31.
  • Zhao X. et al., 2012, Breast Cancer Res Treat. 134 (1): 171-80.
  • Dey P. et al., 2012, Clin Cancer Res. 18 (22): 6188-98.
  • Size / Price
    Catalog: HG14311-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"