After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human COL4A3BP natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human COL4A3BP cDNA Clone Product Information
Gene_bank_ref_id:BC000102
RefSeq ORF Size:1797bp
cDNA Description:Full length Clone DNA of Homo sapiens collagen, type IV, alpha 3 (Goodpasture antigen) binding protein.
Gene Synonym:CERT, CERTL, FLJ20597, GPBP, STARD11, COL4A3BP
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

COL4A3BP is a member of the StarD2 subfamily. It contains a pleckstrin homology domain at its amino terminus and a START domain towards the end of the molecule. COL4A3BP has a lipid-binding domain that mediates intracellular trafficking of ceramide in a non-vesicular manner. One isoform of COL4A3BP is also involved in ceramide intracellular transport. COL4A3BP specifically phosphorylates the N-terminal region of the non-collagenous domain of the alpha 3 chain of type IV collagen, known as the Goodpasture antigen. An autoimmune response directed at this antigen can cause goodpasture disease.

References
  • Rual JF, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • Granero F, et al. (2005) A human-specific TNF-responsive promoter for Goodpasture antigen-binding protein. FEBS J. 272(20):5291-305.
  • Longo I, et al. (2006) Autosomal recessive Alport syndrome: an in-depth clinical and molecular analysis of five families. Nephrol Dial Transplant. 21(3):665-71.
  • Size / Price
    Catalog: HG14306-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"