After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CPNE1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CPNE1 cDNA Clone Product Information
Gene_bank_ref_id:BC001142
RefSeq ORF Size:1614bp
cDNA Description:Full length Clone DNA of Homo sapiens copine I.
Gene Synonym:RP1-309K20.2, COPN1, CPN1, MGC1142, CPNE1
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Copine I, also known as CPN1, is a member of the copine family. Copine I is a calcium-dependent membrane-binding protein which has a wide tissue distribution. Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. Copine I contains two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus, while it does not contain a predicted signal sequence or transmembrane domains. Copine I may function in membrane trafficking.

References
  • Cowland JB, et al. (2003) Tissue expression of copines and isolation of copines I and III from the cytosol of human neutrophils. J Leukoc Biol. 74(3):379-88.
  • Tomsig JL, et al. (2003) Identification of targets for calcium signaling through the copine family of proteins. Characterization of a coiled-coil copine-binding motif. J Biol Chem. 278 (12):10048-54.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Size / Price
    Catalog: HG14283-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"