Quick Order

Text Size:AAA

Human DARS natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DARS cDNA Clone Product Information
NCBI RefSeq:BC000629
RefSeq ORF Size:1506bp
cDNA Description:Full length Clone DNA of Homo sapiens aspartyl-tRNA synthetase.
Gene Synonym:PIG40, DKFZp781B11202, MGC111579, DARS
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Aspartate tRNA ligase 1, also known as DARS, is part of a multienzyme complex of aminoacyl-tRNA synthetases. It belongs to the class-II aminoacyl-tRNA synthetase family. DARS charges its cognate tRNA with aspartate during protein biosynthesis. DARS catalyzes the specific attachment of an amino acid to its cognate tRNA in a 2 step reaction: the amino acid(AA) is first activated by ATP to form AA-AMP and then transferred to the acceptor end of the tRNA.

References
  • Escalante C, et al. (1993) Expression of human aspartyl-tRNA synthetase in Escherichia coli. Functional analysis of the N-terminal putative amphiphilic helix. J Biol Chem. 268(8): 6014-23.
  • Maruyama K, et al. (1994) Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene. 138(1-2):171-4.
  • Reed VS, et al. (1995) Mechanisms of the transfer of aminoacyl-tRNA from aminoacyl-tRNA synthetase to the elongation factor 1 alpha. J Biol Chem. 269(52):32932-6.
  • Size / Price
    Catalog: HG14278-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"