Quick Order

Human ENO3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ENO3cDNA Clone Product Information
cDNA Size:1305
cDNA Description:ORF Clone of Homo sapiens enolase 3 (beta, muscle) DNA.
Gene Synonym:GSD13, MSE, ENO3
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

ENO3 is one of the three enolase isoenzymes found in mammals. As a homodimer, ENO3 is found in skeletal muscle cells in the adult. A switch from alpha enolase to beta enolase occurs in muscle tissue during development in rodents. Mutations in ENO3 gene can be associated with metabolic myopathies that may result from decreased stability of the enzyme. Two transcripts have been identified for ENO3 gene that differ only in their 5' UTR. ENO3 may play a role in muscle development and regeneration. It appears to have a function in striated muscle development and regeneration.

  • Peshavaria M, et al. (1989) Structure of human muscle (beta) enolase mRNA and protein deduced from a genomic clone. Nucleic Acids Res. 17(21):8862.
  • Calì L, et al. (1990) Nucleotide sequence of a cDNA encoding the human muscle-specific enolase (MSE). Nucleic Acids Res. 18(7):1893.
  • Peshavaria M, et al. (1991) Molecular structure of the human muscle-specific enolase gene (ENO3). Biochem J. 275(2):427-33.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items